Skip to main content
Addgene

P-del (pTransluc-miR-145-2)
(Plasmid #21500)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 21500 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pTransluc (Panomics)
  • Backbone size w/o insert (bp) 4800
  • Vector type
    Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    0.9 kb 5' of miR-145
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    900
  • Entrez Gene
    MIR145 (a.k.a. MIRN145, miR-145, miRNA145)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site Bgl Ii (not destroyed)
  • 5′ sequencing primer ggtaccgagctcttacgcgt sequencing primer sequence
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    P-del (pTransluc-miR-145-2) was a gift from Kenneth Kosik (Addgene plasmid # 21500 ; http://n2t.net/addgene:21500 ; RRID:Addgene_21500)

  • For your References section:

    MicroRNA-145 regulates OCT4, SOX2, and KLF4 and represses pluripotency in human embryonic stem cells. Xu N, Papagiannakopoulos T, Pan G, Thomson JA, Kosik KS. Cell. 2009 May 15. 137(4):647-58. 10.1016/j.cell.2009.02.038 PubMed 19409607
Related items:
Commonly requested with: