P-miR-145 (pTransluc-miR-145-1)
(Plasmid #21496)

• Depositing Lab: Kenneth Kosik
• Publication: Xu et al Cell. 2009 May 15. 137(4):647-58.

Backbone

• Vector backbone: pTransluc (Panomics)
• Backbone size w/o insert (bp): 4800
• Vector type: Luciferase

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: 1.5kb 5' of miR-145
• Species: H. sapiens (human)
• Insert Size (bp): 1500
• Entrez Gene: MIR145 (a.k.a. MIRN145, miR-145, miRNA145)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: Bgl II (not destroyed)
• 5′ sequencing primer: ggtaccgagctcttacgcgt sequencing primer sequence

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Plasmid 21496: P-miR-145 (pTransluc-miR-145-1) has a mutation in the miR-145 sequence resulting in A to G mutation. The mutation is a SNP from the human ES cells H9.