Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

12URA-B-ScTop2∆CTD
(Plasmid #214924)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 214924 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    12URA-B
  • Backbone manufacturer
    MacroLab
  • Backbone size w/o insert (bp) 7999
  • Total vector size (bp) 11527
  • Vector type
    Yeast Expression
  • Selectable markers
    URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    topoisomerase II
  • Alt name
    TOP2
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    3528
  • Mutation
    Deleted amino acids 1178-1428
  • GenBank ID
    M13814.1
  • Promoter Gal 1/10
  • Tag / Fusion Protein
    • 6x His-TEV (N terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CTGCATAACCACTTTAACTAATAC
  • 3′ sequencing primer GTAAATGCATGTATACTAAACTC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    MacroLab (12URA-B ), available through Addgene (https://www.addgene.org/48304/). Cloned by Bryan H Schmidt, James Berger lab

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    12URA-B-ScTop2∆CTD was a gift from James Berger (Addgene plasmid # 214924 ; http://n2t.net/addgene:214924 ; RRID:Addgene_214924)