pET-28a(+)-T7-OmpA-MNaseB-6xHis
(Plasmid
#214809)
-
PurposeExpression of 6xhis-tagged micrococcal nuclease B (MNaseB)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 214809 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET28
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5242
- Total vector size (bp) 5809
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameOmpA-Micrococcal nuclease B
-
Alt nameOmpA-MNaseB
-
SpeciesStaphylococcus aureus
-
Insert Size (bp)567
- Promoter T7 promoter
-
Tag
/ Fusion Protein
- 6xhis (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET-28a(+)-T7-OmpA-MNaseB-6xHis was a gift from Peter Sarin (Addgene plasmid # 214809 ; http://n2t.net/addgene:214809 ; RRID:Addgene_214809) -
For your References section:
Purification of micrococcal nuclease for use in ribosomal profiling of high-salinity extremophiles. Gregorova P, Isada M, DiRuggiero J, Sarin LP. JBC, 108020, Nov 2024 10.1016/j.jbc.2024.108020