pAAV-EF1a-PGD2-1.1
(Plasmid
#214764)
-
PurposeAAV packaging plasmid for GRAB PGD2-1.1 fluorescent sensor under EF1alpha promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 214764 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV-EF1alpah
- Total vector size (bp) 7045
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGRAB-PGD2-1.1 sensor
-
SpeciesSynthetic
-
Insert Size (bp)1929
- Promoter EF-1-alpha promoter
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
- 3′ sequencing primer GGAGGAGAAAATGAAAGCCA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-EF1a-PGD2-1.1 was a gift from Yulong Li (Addgene plasmid # 214764 ; http://n2t.net/addgene:214764 ; RRID:Addgene_214764) -
For your References section:
Prolonged sleep deprivation induces a cytokine-storm-like syndrome in mammals. Sang D, Lin K, Yang Y, Ran G, Li B, Chen C, Li Q, Ma Y, Lu L, Cui XY, Liu Z, Lv SQ, Luo M, Liu Q, Li Y, Zhang EE. Cell. 2023 Dec 7;186(25):5500-5516.e21. doi: 10.1016/j.cell.2023.10.025. Epub 2023 Nov 27. 10.1016/j.cell.2023.10.025 PubMed 38016470