pCI AscI MR1 R9H res
(Plasmid #214753)

• Purpose: expresses human MR1 R9H resistant to CRISPR editing with a specific sgRNA in mammalian cells
• Depositing Lab: David Lewinsohn
• Publication: bioRxiv -- Delivery of loaded MR1 monomer results in efficient ligand exchange to host MR1 and subsequent MR1T cell activation (unpublished)

Backbone

• Vector backbone: pCI
• Backbone manufacturer: Promega
• Backbone size w/o insert (bp): 4017
• Total vector size (bp): 6363
• Modifications to backbone: inserted AscI restriction site upstream of CMV promoter - see Karamooz et al, 2019 (PMID: 30886396)
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: MHC class I-related protein 1
• Alt name: MR1
• Species: H. sapiens (human)
• Insert Size (bp): 2381
• Mutation: silent mutations to prevent editing by CRISPR/Cas9 + sgRNA A from Laugel et al (PMID: 27307560) and Arg9 mutated to His (R9H) to prevent presentation of 5-OP-RU as described in Howson et al, 2020 (PMID: 32709702)
• GenBank ID: NM_001531.3
• Entrez Gene: MR1 (a.k.a. HLALS)
• Promoter: CMV
• Tag / Fusion Protein:
  • IRES eGFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: XmaI (not destroyed)
• 5′ sequencing primer: CAGCTCTTAAGGCTAGAGTA
• 3′ sequencing primer: ctgagcaaagaccccaacgagaa

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Insert was designed based on NM_001531.3 and Howson et al, 2020 (PMID: 32709702) with the IRES found in Olive et al, 2014 (PMID: 24439903) and ordered from Thermo Fisher Gene Art

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry