pCI AscI MR1 res
(Plasmid
#214752)
-
Purposeexpresses human MR1 resistant to CRISPR editing with a specific sgRNA in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 214752 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCI
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 4017
- Total vector size (bp) 6363
-
Modifications to backboneinserted AscI restriction site upstream of CMV promoter - see Karamooz et al, 2019 (PMID: 30886396)
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMHC class I-related protein 1
-
Alt nameMR1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2381
-
Mutationsilent mutations to prevent editing by CRISPR/Cas9 + sgRNA A from Laugel et al (PMID: 27307560)
-
GenBank IDNM_001531.3
-
Entrez GeneMR1 (a.k.a. HLALS)
- Promoter CMV
-
Tag
/ Fusion Protein
- IRES eGFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XmaI (not destroyed)
- 5′ sequencing primer CAGCTCTTAAGGCTAGAGTA
- 3′ sequencing primer ctgagcaaagaccccaacgagaa (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byInsert was designed based on NM_001531.3 with the IRES found in Olive et al, 2014 (PMID: 24439903) and ordered from Thermo Fisher Gene Art
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCI AscI MR1 res was a gift from David Lewinsohn (Addgene plasmid # 214752 ; http://n2t.net/addgene:214752 ; RRID:Addgene_214752) -
For your References section:
Delivery of loaded MR1 monomer results in efficient ligand exchange to host MR1 and subsequent MR1T cell activation. Kulicke CA, Swarbrick GM, Ladd NA, Cansler M, Null M, Worley A, Lemon C, Ahmed T, Bennett J, Lust TN, Heisler CM, Huber ME, Krawic JR, Ankley LM, McBride SK, Tafesse FG, Olive AJ, Hildebrand WH, Lewinsohn DA, Adams EJ, Lewinsohn DM, Harriff MJ. Commun Biol. 2024 Feb 24;7(1):228. doi: 10.1038/s42003-024-05912-4. 10.1038/s42003-024-05912-4 PubMed 38402309