Skip to main content
Addgene

pAAV CMV-DIO-(mCherry-U6)-shRNA(anti-Crh)
(Plasmid #214732)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 214732 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    PX552
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    anti-Crh shRNA / mCherry
  • gRNA/shRNA sequence
    shRNA2: GCATGGGTGAAGAATACTTCC
  • Species
    Synthetic

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer unknown
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV CMV-DIO-(mCherry-U6)-shRNA(anti-Crh) was a gift from Félix Leroy (Addgene plasmid # 214732 ; http://n2t.net/addgene:214732 ; RRID:Addgene_214732)
  • For your References section:

    Corticotropin-releasing hormone signaling from prefrontal cortex to lateral septum suppresses interaction with familiar mice. de Leon Reyes NS, Sierra Diaz P, Nogueira R, Ruiz-Pino A, Nomura Y, de Solis CA, Schulkin J, Asok A, Leroy F. Cell. 2023 Sep 14;186(19):4152-4171.e31. doi: 10.1016/j.cell.2023.08.010. Epub 2023 Sep 4. 10.1016/j.cell.2023.08.010 PubMed 37669667