pAAV CMV-DIO-(mCherry-U6)-shRNA(anti-Crh)
(Plasmid
#214732)
-
PurposeExpresses shRNA against CRH, marked with mCherry, in infected and cre positive cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 214732 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonePX552
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameanti-Crh shRNA / mCherry
-
gRNA/shRNA sequenceshRNA2: GCATGGGTGAAGAATACTTCC
-
SpeciesSynthetic
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer unknown (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV CMV-DIO-(mCherry-U6)-shRNA(anti-Crh) was a gift from Félix Leroy (Addgene plasmid # 214732 ; http://n2t.net/addgene:214732 ; RRID:Addgene_214732) -
For your References section:
Corticotropin-releasing hormone signaling from prefrontal cortex to lateral septum suppresses interaction with familiar mice. de Leon Reyes NS, Sierra Diaz P, Nogueira R, Ruiz-Pino A, Nomura Y, de Solis CA, Schulkin J, Asok A, Leroy F. Cell. 2023 Sep 14;186(19):4152-4171.e31. doi: 10.1016/j.cell.2023.08.010. Epub 2023 Sep 4. 10.1016/j.cell.2023.08.010 PubMed 37669667