pT7-AGG-SpCas9
(Plasmid
#214603)
-
Purposeencode SpCas9; in vitro transcribed modified RNA vector
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 214603 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepUC57
-
Vector typeCRISPR, Unspecified
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSpCas9
- Promoter T7
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gacaagaagtacagcatcgg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pT7-AGG-SpCas9 was a gift from Yuxuan Guo (Addgene plasmid # 214603 ; http://n2t.net/addgene:214603 ; RRID:Addgene_214603) -
For your References section:
Modified mRNA-based gene editing reveals sarcomere-based regulation of gene expression in human induced-pluripotent stem cell-derived cardiomyocytes. Huang Y, Zhang Y, Wang Z, Miao L, Tan P, Guan Y, Ran Y, Feng X, Wang Y, Guo Y, Guo X. Int Immunopharmacol. 2024 Oct 17;143(Pt 2):113378. doi: 10.1016/j.intimp.2024.113378. 10.1016/j.intimp.2024.113378 PubMed 39423657