mCherry-Vector
(Plasmid #214477)

• Purpose: Vector control for mCherry fusions. Created from the backbone of Addgene #55043 mCherry-Ezrin-N-14 from Michael Davidson.
• Depositing Lab: Natalie Ahn
• Publication: Miller et al Mol Biol Cell. 2023 Dec 20:mbcE23060255. doi: 10.1091/mbc.E23-06-0255.

Backbone

• Vector backbone: mCherry-Ezrin-N-14
• Backbone manufacturer: Michael Davidson, Addgene Plasmid #55043
• Total vector size (bp): 4690
• Modifications to backbone: The backbone of mCherry-Ezrin-N-14 from Michael Davidson was PCR amplified and ligated to generate the vector.
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: mCherry
• Species: Discosoma sp (sea anemone)
• Promoter: CMV

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: GAAATTTGTGATGCTATTGC

Resource Information

• Supplemental Documents:
  • mCherry-Vector_Predicted.gb
  • mCherry-Vector_Sanger-Consensus_656-1580.gb
• A portion of this plasmid was derived from a plasmid made by: Source plasmid was obtained from Addgene (plasmid # 55043 mCherry-Ezrin-N-14), from Michael Davidson.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid was created by PCR amplifying the backbone of Addgene plasmid # 55043 (a gift from Michael Davidson; http://n2t.net/addgene:55043; RRID:Addgene_55043) followed by ligation of the linear product. The primers for PCR amplification are available in the supplemental materials for Miller et al.