RDX-mCherry
(Plasmid #214476)

• Purpose: Plasmid for transient transfection of RDX-mCherry fusion protein in mammalian cells.
• Depositing Lab: Natalie Ahn
• Publication: Miller et al Mol Biol Cell. 2023 Dec 20:mbcE23060255. doi: 10.1091/mbc.E23-06-0255.

Backbone

• Vector backbone: mCherry-Ezrin-N-14
• Backbone manufacturer: Michael Davidson, Addgene Plasmid #55043
• Total vector size (bp): 6439
• Modifications to backbone: Removed ezrin insert and replaced with RDX (radixin) insert.
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: RDX
• Alt name: radixin
• Species: H. sapiens (human)
• Mutation: Sequence matches cDNA clone MGC:48283 IMAGE:5284438 (GenBank Accession BC047109.1) which differs from the canonical sequence at one amino acid (K328E).
• Entrez Gene: RDX (a.k.a. DFNB24)
• Promoter: CMV
• Tag / Fusion Protein:
  • mCherry (C terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: GAAATTTGTGATGCTATTGC

Resource Information

• Supplemental Documents:
  • RDX-mCherry_Predicted.gb
  • RDX-mCherry_Sanger-Consensus_672-3275.gb
• A portion of this plasmid was derived from a plasmid made by: CCSB-Boad Lentiviral Expression Library plasmid ccsbBroad304_06855 from the Functional Genomics facility at the University of Colorado Anschutz Medical Campus, Denver, CO.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Plasmid was generated by PCR amplifying RDX from the CCSB-Broad Lentiviral Expression Library collection (ccsbBroad304_06855, source clone GenBank accession: BC047109) and inserting it into the mCherry backbone which was PCR amplified from mCherry-Ezrin-N-14, a gift from Michael Davidson (Addgene plasmid # 55043 ; http://n2t.net/addgene:55043 ; RRID:Addgene_55043). RDX was inserted into the backbone using the FastCloning method (Li et al., 2011, BMC Biotechnol 11, 92). The primer sequences for FastCloning and internal sequencing primers are included in the supplemental material for Miller et al.