Skip to main content
Addgene

MCAM-GFP
(Plasmid #214475)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 214475 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    CSII-Rfa-IRES-Hygro Lentiviral Dest
  • Backbone manufacturer
    Xuedong Liu, University of Colorado Boulder
  • Backbone size w/o insert (bp) 12467
  • Total vector size (bp) 13588
  • Vector type
    Mammalian Expression, Lentiviral ; Gateway
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    MCAM
  • Alt name
    Melanoma Cell Adhesion Molecule
  • Alt name
    CD146
  • Alt name
    Muc18
  • Species
    H. sapiens (human)
  • Entrez Gene
    MCAM (a.k.a. CD146, HEMCAM, METCAM, MUC18, MelCAM)
  • Promoter EF-1a
  • Tag / Fusion Protein
    • EGFP (C terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
  • 3′ sequencing primer ACTTTGTACAAGAAAGCTGGG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    CCSB-Boad Lentiviral Expression Library plasmid ccsbBroad304_06567, from the Functional Genomics facility, University of Colorado Anschutz Medical Campus, Denver, CO.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Detailed information on cloning, including cloning of entry vector, cloning and internal sequencing primers, and entry vector sequences are available in the supplemental materials for Miller et al. EGFP DNA was a gift from Amy Palmer, University of Colorado Boulder.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MCAM-GFP was a gift from Natalie Ahn (Addgene plasmid # 214475 ; http://n2t.net/addgene:214475 ; RRID:Addgene_214475)
  • For your References section:

    Cooperative polarization of MCAM/CD146 and ERM family proteins in melanoma. Miller SG, Hoh M, Ebmeier CC, Tay JW, Ahn NG. Mol Biol Cell. 2023 Dec 20:mbcE23060255. doi: 10.1091/mbc.E23-06-0255. 10.1091/mbc.E23-06-0255 PubMed 38117590