Lyn11-BirA*-HA
(Plasmid #214474)

• Purpose: Lentiviral vector for expression in mammalian cells of the proximity ligase BirA(R118G) with an N-terminal Lyn11 plasma membrane localization sequence and C-terminal HA tag.
• Depositing Lab: Natalie Ahn
• Publication: Miller et al Mol Biol Cell. 2023 Dec 20:mbcE23060255. doi: 10.1091/mbc.E23-06-0255.

Backbone

• Vector backbone: CSII-Rfa-IRES-Hygro Lentiviral Dest
• Backbone manufacturer: Xuedong Liu, University of Colorado Boulder
• Backbone size w/o insert (bp): 12467
• Total vector size (bp): 12069
• Vector type: Mammalian Expression, Lentiviral ; Gateway
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: BirA(R118G)
• Alt name: BioID
• Species: E. coli (bacteria)
• Mutation: R118G
• Promoter: EF-1a
• Tags / Fusion Proteins:
  • Lyn11 (Plasma Membrane Localization Sequence) (N terminal on insert)
  • HA tag (C terminal on insert)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: TCAAGCCTCAGACAGTGGTTC
• 3′ sequencing primer: ACTTTGTACAAGAAAGCTGGG

Resource Information

• Supplemental Documents:
  • Lyn11-BirA-HA_Predicted.gb
  • Lyn11-BirA-HA_Sanger-Consensus_3748-5021.gb
• A portion of this plasmid was derived from a plasmid made by: From Addgene plasmid # 53581, from Karl Kramer.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This construct was used for BioID experiments (Roux et al., 2012, J Cell Biol 196, 801-810). BirA*-HA was inserted into an entry vector by PCR amplifying from Addgene plasmid # 53581 (a gift from Karl Kramer; http://n2t.net/addgene:53581 ; RRID:Addgene_53581). The Lyn11 plasma membrane localization sequence is from Inoue et al. (2005, Nat Methods 2, 415-418). Details on cloning and the sequences of entry vectors, cloning primers, and internal sequencing primers are provided in the supplemental material for Miller et al.