Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

piggyBAC-BRD4-Flag
(Plasmid #214432)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 214432 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLeicester38
  • Backbone size w/o insert (bp) 7000
  • Total vector size (bp) 11175
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Brd4 bromodomain containing 4
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    4282
  • GenBank ID
    NM_020508.4 NM_001286630.1
  • Entrez Gene
    Brd4 (a.k.a. Brd5, HUNK1, MCAP, WI-11513)
  • Promoter EF1
  • Tag / Fusion Protein
    • FLAG (N terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer ctgaccctgcttgctcaactc
  • 3′ sequencing primer ccctaacgttactggccgaa
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    piggyBAC-BRD4-Flag was a gift from Shaun Cowley (Addgene plasmid # 214432 ; http://n2t.net/addgene:214432 ; RRID:Addgene_214432)