SF-SON IRES Puro
(Plasmid
#214402)
-
PurposeExpresses human SOX10, OLIG2, NKX6.2 and PAC (puromycin N-acetyl-transferase)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 214402 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepRRL.SF-IRES-Pac
- Backbone size w/o insert (bp) 7812
- Total vector size (bp) 11141
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GTA ACG CCA TTT TGC AAG GCA TG
- 3′ sequencing primer gccacaaccatgaccgagtacaag (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
SF-SON IRES Puro was a gift from Tanja Kuhlmann (Addgene plasmid # 214402 ; http://n2t.net/addgene:214402 ; RRID:Addgene_214402) -
For your References section:
Rapid and efficient generation of oligodendrocytes from human induced pluripotent stem cells using transcription factors. Ehrlich M, Mozafari S, Glatza M, Starost L, Velychko S, Hallmann AL, Cui QL, Schambach A, Kim KP, Bachelin C, Marteyn A, Hargus G, Johnson RM, Antel J, Sterneckert J, Zaehres H, Scholer HR, Baron-Van Evercooren A, Kuhlmann T. Proc Natl Acad Sci U S A. 2017 Mar 14;114(11):E2243-E2252. doi: 10.1073/pnas.1614412114. Epub 2017 Feb 28. 10.1073/pnas.1614412114 PubMed 28246330