Skip to main content
Addgene

SF-SON IRES Puro
(Plasmid #214402)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 214402 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pRRL.SF-IRES-Pac
  • Backbone size w/o insert (bp) 7812
  • Total vector size (bp) 11141
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    SOX10, Olig2, NKX6.2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3200
  • Entrez Gene
    SOX10 (a.k.a. DOM, PCWH, SOX-10, WS2E, WS4, WS4C)
  • Entrez Gene
    OLIG2 (a.k.a. BHLHB1, OLIGO2, PRKCBP2, RACK17, bHLHe19)
  • Entrez Gene
    NKX6-2 (a.k.a. GTX, NKX6.2, NKX6B, SPAX8)
  • Promoter SFFV

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer GTA ACG CCA TTT TGC AAG GCA TG
  • 3′ sequencing primer gccacaaccatgaccgagtacaag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    SF-SON IRES Puro was a gift from Tanja Kuhlmann (Addgene plasmid # 214402 ; http://n2t.net/addgene:214402 ; RRID:Addgene_214402)
  • For your References section:

    Rapid and efficient generation of oligodendrocytes from human induced pluripotent stem cells using transcription factors. Ehrlich M, Mozafari S, Glatza M, Starost L, Velychko S, Hallmann AL, Cui QL, Schambach A, Kim KP, Bachelin C, Marteyn A, Hargus G, Johnson RM, Antel J, Sterneckert J, Zaehres H, Scholer HR, Baron-Van Evercooren A, Kuhlmann T. Proc Natl Acad Sci U S A. 2017 Mar 14;114(11):E2243-E2252. doi: 10.1073/pnas.1614412114. Epub 2017 Feb 28. 10.1073/pnas.1614412114 PubMed 28246330