KIF5A-GFP-SspB
(Plasmid #214401)

• Purpose: Expresses fusion of Kinesin heavy chain 5A (1-572) with GFP and SspB (micro)
• Depositing Lab: Liting Duan
• Publication: Liu et al Proc Natl Acad Sci U S A. 2024 Apr 2;121(14):e2217019121. doi: 10.1073/pnas.2217019121. Epub 2024 Mar 28.

Backbone

• Vector backbone: pEGFPN1
• Backbone size w/o insert (bp): 4733
• Total vector size (bp): 6790
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: KIF5A-GFP-SspB
• Alt name: Kif5a
• Species: R. norvegicus (rat), Synthetic
• Insert Size (bp): 2844
• Entrez Gene: Kif5a
• Promoter: CMV
• Tag / Fusion Protein:
  • KIF5A-GFP-SspB (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: CMV Forward
• 3′ sequencing primer: CCTCTACAAATGTGGTATGG

Resource Information

• Supplemental Documents:
  • KIF5A-GFP-SspB.gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/2022.10.27.513965v1 for bioRxiv preprint.