pcDNA3.1-Hyg-BFP
(Plasmid
#214363)
-
PurposeExpression of the Blue Fluorescent Protein
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 214363 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA3.1-(-)-Hyg
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBFP
-
SpeciesAequorea victoria
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRV (destroyed during cloning)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer GGCTAACTAGAGAACCCACTG
- 3′ sequencing primer GGCAACTAGAAGGCACAGTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1-Hyg-BFP was a gift from Bertrand Collet (Addgene plasmid # 214363 ; http://n2t.net/addgene:214363 ; RRID:Addgene_214363) -
For your References section:
Unexpected regulatory functions of cyprinid Viperin on inflammation and metabolism. Chaumont L, Jouneau L, Huetz F, van Muilekom DR, Peruzzi M, Raffy C, Le Hir J, Minke J, Boudinot P, Collet B. BMC Genomics. 2024 Jun 29;25(1):650. doi: 10.1186/s12864-024-10566-x. 10.1186/s12864-024-10566-x PubMed 38951796