pAAV-hsyn-DIO-Rpl22l1-3Flag-2A-eGFP-WPRE
(Plasmid
#214265)
-
PurposeExpression of a Flag-tagged Rpl22I1 protein in cells expressing Cre recombinase allowing for the harvesting of actively transcribed mRNAs in that cell type.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 214265 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
-
How this works
- Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepFB
-
Backbone manufacturerVirovek
- Backbone size w/o insert (bp) 4825
- Total vector size (bp) 8009
-
Modifications to backboneN/A
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameFlag-tagged Rpl22I1 protein expressing Cre Recombinase
-
Alt nameRibosomal protein L22-like1
-
Alt nameRPL22L1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)3184
-
MutationN/A
-
GenBank IDNM_001347226.3
-
Entrez GeneRpl22 (a.k.a. 2700038K18Rik)
- Promoter Synapsin
-
Tag
/ Fusion Protein
- EGFP (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CCCAGCCGGACCGCACCACGC
- 3′ sequencing primer GGCGATACTCACATTCAGAACC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byORF clone purchased from Origene cat # MR200606
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hsyn-DIO-Rpl22l1-3Flag-2A-eGFP-WPRE was a gift from D. James Surmeier (Addgene plasmid # 214265 ; http://n2t.net/addgene:214265 ; RRID:Addgene_214265)