pAAV-hsyn-DIO-Rpl22l1-3Flag-2A-eGFP-WPRE
(Plasmid #214265)

• Purpose: Expression of a Flag-tagged Rpl22I1 protein in cells expressing Cre recombinase allowing for the harvesting of actively transcribed mRNAs in that cell type.
• Depositing Lab: D. James Surmeier
• Publication: GABAergic regulation of striatal spiny projection neuron depends upon their activity state. (unpublished)

Backbone

• Vector backbone: pFB
• Backbone manufacturer: Virovek
• Backbone size w/o insert (bp): 4825
• Total vector size (bp): 8009
• Modifications to backbone: N/A
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Flag-tagged Rpl22I1 protein expressing Cre Recombinase
• Alt name: Ribosomal protein L22-like1
• Alt name: RPL22L1
• Species: M. musculus (mouse)
• Insert Size (bp): 3184
• Mutation: N/A
• GenBank ID: NM_001347226.3
• Entrez Gene: Rpl22 (a.k.a. 2700038K18Rik)
• Promoter: Synapsin
• Tag / Fusion Protein:
  • EGFP (N terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: CCCAGCCGGACCGCACCACGC
• 3′ sequencing primer: GGCGATACTCACATTCAGAACC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: ORF clone purchased from Origene cat # MR200606

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry