pSG069
(Plasmid
#214260)
-
PurposepJN105 with PaftsH2SD and PaFtsH2 ORF cloned between NheI/XbaI
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 214260 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepJN105
- Backbone size w/o insert (bp) 6055
- Total vector size (bp) 7924
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Gentamicin, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nametLST accessory genetic element encoded PaFtsH2 proteinase from Pseudomonas aeruginosa SG17M
-
SpeciesPseudomonas aeruginosa SG17M
-
Insert Size (bp)1899
-
GenBank IDNZ_JALF00000000.1 Z695_RS45375
- Promoter araBAD promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (unknown if destroyed)
- 3′ cloning site XbaI (unknown if destroyed)
- 5′ sequencing primer CGCGCTAGCTTGCGAGGAACATTGCCCATG
- 3′ sequencing primer GCGTCTAGATCATGGTGTGGACCCTTGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSG069 was a gift from Ute Romling (Addgene plasmid # 214260 ; http://n2t.net/addgene:214260 ; RRID:Addgene_214260) -
For your References section:
The membrane-cytoplasmic linker defines activity of FtsH proteases in Pseudomonas aeruginosa clone C. Mawla GD, Kamal SM, Cao LY, Purhonen P, Hebert H, Sauer RT, Baker TA, Romling U. J Biol Chem. 2024 Feb;300(2):105622. doi: 10.1016/j.jbc.2023.105622. Epub 2024 Jan 3. 10.1016/j.jbc.2023.105622 PubMed 38176647