Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

lenti-EGFR-L858R-T790M-dual-nick sgRNA
(Plasmid #214101)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 214101 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    lenti-sgRNA blast (Plasmid #104993)
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    EGFR L858R nicking sgRNA/EGFR T790M nicking sgRNA
  • gRNA/shRNA sequence
    TTACTTTGCCTCCTTCTGCA; CCTCCAGGAAGCCTACGTGA
  • Species
    Synthetic
  • Promoter hU6

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer attacagggacagcagagatccag
  • 3′ sequencing primer actgtgggcgatgtgcgctctgccc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    lenti-EGFR-L858R-T790M-dual-nick sgRNA was a gift from Ting Zhou (Addgene plasmid # 214101 ; http://n2t.net/addgene:214101 ; RRID:Addgene_214101)
  • For your References section:

    A robust and inducible precise genome editing via an all-in-one prime editor in human pluripotent stem cells. Wu Y, Zhong A, Sidharta M, Kim TW, Ramirez B, Persily B, Studer L, Zhou T. bioRxiv [Preprint]. 2024 Jan 19:2024.01.18.576233. doi: 10.1101/2024.01.18.576233. 10.1101/2024.01.18.576233 PubMed 38293122