lenti-GBA-N370S-nick sgRNA
(Plasmid
#214096)
-
PurposeLentiviral vector expressing nicking sgRNA to induce GBA N370S mutation using PE3
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 214096 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonelenti-sgRNA blast (Plasmid #104993)
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKRAS G13A nicking sgRNA
-
gRNA/shRNA sequenceACCCTTACCTACACTCTCTG
-
SpeciesSynthetic
- Promoter hU6
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer LKO.1 5' (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
lenti-GBA-N370S-nick sgRNA was a gift from Ting Zhou (Addgene plasmid # 214096 ; http://n2t.net/addgene:214096 ; RRID:Addgene_214096) -
For your References section:
A robust and inducible precise genome editing via an all-in-one prime editor in human pluripotent stem cells. Wu Y, Zhong A, Sidharta M, Kim TW, Ramirez B, Persily B, Studer L, Zhou T. bioRxiv [Preprint]. 2024 Jan 19:2024.01.18.576233. doi: 10.1101/2024.01.18.576233. 10.1101/2024.01.18.576233 PubMed 38293122