lenti-EGFR-L858R-tmpknot-epegRNA
(Plasmid
#214092)
-
PurposeLentiviral vector expressing epegRNA to induce EGFR L858R mutation
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 214092 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonelenti-tmpknot-epegRNA-puro backbone
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEGFR L858R epegRNA
-
gRNA/shRNA sequenceCAAGATCACAGATTTTGGGC
-
SpeciesSynthetic
- Promoter hU6
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer LKO.1 5' (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
lenti-EGFR-L858R-tmpknot-epegRNA was a gift from Ting Zhou (Addgene plasmid # 214092 ; http://n2t.net/addgene:214092 ; RRID:Addgene_214092) -
For your References section:
A robust and inducible precise genome editing via an all-in-one prime editor in human pluripotent stem cells. Wu Y, Zhong A, Sidharta M, Kim TW, Ramirez B, Persily B, Studer L, Zhou T. bioRxiv [Preprint]. 2024 Jan 19:2024.01.18.576233. doi: 10.1101/2024.01.18.576233. 10.1101/2024.01.18.576233 PubMed 38293122