Skip to main content
Addgene

pAAV-pCALM1-sFLEx-HA-SpCas9-miniU6-sgRNAShank3
(Plasmid #213969)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 213969 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV-hSyn1-EYFP
  • Vector type
    AAV, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Shank3 sgRNA
  • gRNA/shRNA sequence
    gcaggagcccagcaggctgg
  • Species
    M. musculus (mouse)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer N/A
  • 3′ sequencing primer N/A
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-pCALM1-sFLEx-HA-SpCas9-miniU6-sgRNAShank3 was a gift from Zhonghua Lu (Addgene plasmid # 213969 ; http://n2t.net/addgene:213969 ; RRID:Addgene_213969)
  • For your References section:

    An ultra-compact promoter drives widespread neuronal expression in mouse and monkey brains. Wang J, Lin J, Chen Y, Liu J, Zheng Q, Deng M, Wang R, Zhang Y, Feng S, Xu Z, Ye W, Hu Y, Duan J, Lin Y, Dai J, Chen Y, Li Y, Luo T, Chen Q, Lu Z. Cell Rep. 2023 Nov 28;42(11):113348. doi: 10.1016/j.celrep.2023.113348. Epub 2023 Oct 31. 10.1016/j.celrep.2023.113348 PubMed 37910509