pAAV-pCALM1-sFLEx-HA-SpCas9-miniU6-sgRNAShank3
(Plasmid
#213969)
-
PurposeAAV vector for encoding SpCas9 driven by pCALM1 promoter targeting Shank3 locus in the presence of Cre recombinase
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 213969 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV-hSyn1-EYFP
-
Vector typeAAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameShank3 sgRNA
-
gRNA/shRNA sequencegcaggagcccagcaggctgg
-
SpeciesM. musculus (mouse)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer N/A
- 3′ sequencing primer N/A (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-pCALM1-sFLEx-HA-SpCas9-miniU6-sgRNAShank3 was a gift from Zhonghua Lu (Addgene plasmid # 213969 ; http://n2t.net/addgene:213969 ; RRID:Addgene_213969) -
For your References section:
An ultra-compact promoter drives widespread neuronal expression in mouse and monkey brains. Wang J, Lin J, Chen Y, Liu J, Zheng Q, Deng M, Wang R, Zhang Y, Feng S, Xu Z, Ye W, Hu Y, Duan J, Lin Y, Dai J, Chen Y, Li Y, Luo T, Chen Q, Lu Z. Cell Rep. 2023 Nov 28;42(11):113348. doi: 10.1016/j.celrep.2023.113348. Epub 2023 Oct 31. 10.1016/j.celrep.2023.113348 PubMed 37910509