AWP-031
(Plasmid #213967)

• Purpose: Expresses dPb2Cas12a under an IPTG-inducible promoter and contains a cassette for constitutive CRISPR array expression.
• Depositing Lab: Alexander Westermann
• Publication: Prezza et al Proc Natl Acad Sci U S A. 2024 Feb 6;121(6):e2311323121. doi: 10.1073/pnas.2311323121. Epub 2024 Jan 31.

Backbone

• Vector backbone: pNBU2
• Backbone size w/o insert (bp): 6814
• Total vector size (bp): 10678
• Modifications to backbone: Cassette for constitutive expression of Cas12a arrays. Arrays can be cloned with the CRATES method (PMID: 31270316) and replace the GFP cassette.
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Pir1
• Growth instructions: Erythromycin resistance in Bacteroides.
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Cas12a
• Species: Synthetic; Segatella bryantii
• Insert Size (bp): 3798
• Mutation: D875A to inactivate target nuclease activity
• GenBank ID:
• Entrez Gene: cas12a (a.k.a. L6471_RS03565, L6471_03570)
• Promoter: PcfxA, IPTG inducible
• Tag / Fusion Protein:
  • 3XFLAG (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AscI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: gcttgccctcatctgttacg
• 3′ sequencing primer: caagatccttaatcatcatc

Resource Information

• Supplemental Documents:
  • AWP030.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Derived from pMM704 (Addgene #68891).