Skip to main content
Addgene

AWP-029
(Plasmid #213966)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 213966 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pNBU2
  • Backbone size w/o insert (bp) 6814
  • Total vector size (bp) 10678
  • Modifications to backbone
    Cassette for constitutive expression of Cas12a gRNAs. Spacers can be cloned in the SmaI site.
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Pir1
  • Growth instructions
    Erythromycin resistance in Bacteroides.
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Cas12a
  • Species
    Synthetic; Segatella bryantii
  • Insert Size (bp)
    3798
  • Mutation
    D875A to inactivate target nuclease activity
  • GenBank ID
  • Entrez Gene
    cas12a (a.k.a. L6471_RS03565, L6471_03570)
  • Promoter PcfxA, IPTG inducible
  • Tag / Fusion Protein
    • 3XFLAG (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer gcttgccctcatctgttacg
  • 3′ sequencing primer caagatccttaatcatcatc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Derived from pMM704 (Addgene #68891).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AWP-029 was a gift from Alexander Westermann (Addgene plasmid # 213966 ; http://n2t.net/addgene:213966 ; RRID:Addgene_213966)
  • For your References section:

    CRISPR-based screening of small RNA modulators of bile susceptibility in Bacteroides thetaiotaomicron. Prezza G, Liao C, Reichardt S, Beisel CL, Westermann AJ. Proc Natl Acad Sci U S A. 2024 Feb 6;121(6):e2311323121. doi: 10.1073/pnas.2311323121. Epub 2024 Jan 31. 10.1073/pnas.2311323121 PubMed 38294941