hsKIF5B(1-560)-HaloTag-FRB
(Plasmid
#213899)
-
PurposeImaging of KIF5B fused to HaloTag
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 213899 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneChicken beta-actin
- Backbone size w/o insert (bp) 6062
- Total vector size (bp) 8924
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehsKIF5B(aa1-560)-HaloTag-FRB
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2862
-
GenBank ID3799
-
Entrez GeneKIF5B (a.k.a. HEL-S-61, KINH, KNS, KNS1, UKHC)
-
Tag
/ Fusion Protein
- HaloTag (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (unknown if destroyed)
- 3′ cloning site SnaBI/XbaI (unknown if destroyed)
- 5′ sequencing primer ggcttctggcgtgtgaccggcgg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Internal plasmid ID: pKJ060/pWS095.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
hsKIF5B(1-560)-HaloTag-FRB was a gift from Lukas Kapitein (Addgene plasmid # 213899 ; http://n2t.net/addgene:213899 ; RRID:Addgene_213899)