p105_gRNA_Sa_CD40
(Plasmid
#213781)
-
PurposeExpresses CRISPRa gRNA for CD40 promoter and mScarlet. gRNA driven by mU6.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 213781 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonelentiviral
-
Vector typeLentiviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSa gRNA
-
gRNA/shRNA sequenceGATGCGTCCCTAAACTCCCGG
- Promoter mU6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Esp3I (unknown if destroyed)
- 3′ cloning site Esp3I (unknown if destroyed)
- 5′ sequencing primer NA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p105_gRNA_Sa_CD40 was a gift from Howard Chang (Addgene plasmid # 213781 ; http://n2t.net/addgene:213781 ; RRID:Addgene_213781) -
For your References section:
Bidirectional epigenetic editing reveals hierarchies in gene regulation. Pacalin NM, Steinhart Z, Shi Q, Belk JA, Dorovskyi D, Kraft K, Parker KR, Shy BR, Marson A, Chang HY. Nat Biotechnol. 2024 May 17. doi: 10.1038/s41587-024-02213-3. 10.1038/s41587-024-02213-3 PubMed 38760566