Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLEW-pHluorin2-PTS1
(Plasmid #213776)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 213776 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLEW100v5
  • Backbone size w/o insert (bp) 5560
  • Total vector size (bp) 6292
  • Vector type
    Trypanosoma brucei expression
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    pHlorin2
  • Species
    Synthetic
  • Insert Size (bp)
    732
  • Mutation
    Appended a 2 glycine linker and a T. brucei peroxisome targeting sequence (AKL) at the C-terminus of pHlorin2
  • Promoter T. brucei rRNA promotor

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer CCCTATAGTGAGTCGTATTA
  • 3′ sequencing primer GATTTAGGTGACACTATAG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Synthesized from published AA sequence (https://doi.org/10.4236%2Fabb.2011.23021) at Twist Bioscience

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLEW-pHluorin2-PTS1 was a gift from Kenneth Christensen (Addgene plasmid # 213776 ; http://n2t.net/addgene:213776 ; RRID:Addgene_213776)