pAAV GFP
(Plasmid
#213685)
-
PurposeExpresses Green Fluorescent Protein (GFP) with an N-terminal twin-Strep tag
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 213685 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV CTR0
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTwin-Strep GFP
- Promoter cytomegalovirus enhancer/chicken β-actin promoter
-
Tag
/ Fusion Protein
- Twin-Strep (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer gcaacgtgctggttattgtgc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV GFP was a gift from Thomas Kukar (Addgene plasmid # 213685 ; http://n2t.net/addgene:213685 ; RRID:Addgene_213685) -
For your References section:
Granulins rescue inflammation, lysosome dysfunction, lipofuscin, and neuropathology in a mouse model of progranulin deficiency. Root J, Mendsaikhan A, Taylor G, Merino P, Nandy S, Wang M, Araujo LT, Ryu D, Holler C, Thompson BM, Astarita G, Blain JF, Kukar T. Cell Rep. 2024 Nov 19;43(12):114985. doi: 10.1016/j.celrep.2024.114985. 10.1016/j.celrep.2024.114985 PubMed 39565694