Skip to main content
Addgene

pAAV hGRN4
(Plasmid #213684)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 213684 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV CTR0
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Human granulin-4 (hGRN4)
  • Species
    H. sapiens (human)
  • Entrez Gene
    GRN (a.k.a. CLN11, FTD2, GEP, GP88, PCDGF, PEPI, PGRN)
  • Promoter cytomegalovirus enhancer/chicken β-actin promoter
  • Tag / Fusion Protein
    • Twin-Strep tag and FLAG tag (after signal peptide) (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer gcaacgtgctggttattgtgc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV hGRN4 was a gift from Thomas Kukar (Addgene plasmid # 213684 ; http://n2t.net/addgene:213684 ; RRID:Addgene_213684)
  • For your References section:

    Granulins rescue inflammation, lysosome dysfunction, lipofuscin, and neuropathology in a mouse model of progranulin deficiency. Root J, Mendsaikhan A, Taylor G, Merino P, Nandy S, Wang M, Araujo LT, Ryu D, Holler C, Thompson BM, Astarita G, Blain JF, Kukar T. Cell Rep. 2024 Nov 19;43(12):114985. doi: 10.1016/j.celrep.2024.114985. 10.1016/j.celrep.2024.114985 PubMed 39565694