pAAV hGRN2
(Plasmid
#213683)
-
PurposeExpresses human granulin-2 with an N-terminal twin-Strep-FLAG tag
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 213683 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
-
How this works
- Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV CTR0
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namehuman Granulin-2
-
Alt namehuman Granulin-F
-
SpeciesH. sapiens (human)
-
Insert Size (bp)424
-
GenBank ID
- Promoter cytomegalovirus enhancer/chicken β-actin promoter
-
Tag
/ Fusion Protein
- twin-Strep-FLAG (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer gcaacgtgctggttattgtgc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV hGRN2 was a gift from Thomas Kukar (Addgene plasmid # 213683 ; http://n2t.net/addgene:213683 ; RRID:Addgene_213683) -
For your References section:
Granulins rescue inflammation, lysosome dysfunction, lipofuscin, and neuropathology in a mouse model of progranulin deficiency. Root J, Mendsaikhan A, Taylor G, Merino P, Nandy S, Wang M, Araujo LT, Ryu D, Holler C, Thompson BM, Astarita G, Blain JF, Kukar T. Cell Rep. 2024 Nov 19;43(12):114985. doi: 10.1016/j.celrep.2024.114985. 10.1016/j.celrep.2024.114985 PubMed 39565694