pAAV hPGRN
(Plasmid #213682)

• Purpose: Expresses human progranulin (PGRN) with an N-terminal twin-Strep-V5 tag
• Depositing Lab: Thomas Kukar
• Publication: Root et al Cell Rep. 2024 Nov 19;43(12):114985. doi: 10.1016/j.celrep.2024.114985.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: pAAV CTR0
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Human Progranulin (hPGRN)
• Species: H. sapiens (human)
• Entrez Gene: GRN (a.k.a. CLN11, FTD2, GEP, GP88, PCDGF, PEPI, PGRN)
• Promoter: cytomegalovirus enhancer/chicken β-actin promoter
• Tag / Fusion Protein:
  • Twin-Strep tag and V5 tag (after signal peptide) (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: gcaacgtgctggttattgtgc

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry