pRK5-PLA2G15-6xHis S198A
(Plasmid
#213605)
-
PurposeExpresses PLA2G15-6xHis S198A in mammalian cells
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 213605 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepRK5
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePhospholipase A2 Group XV
-
Alt namePLA2G15
-
Alt nameLysosomal phospholipase A2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1325
-
MutationChanged serine 198 to alanine
-
GenBank ID23659
-
Entrez GenePLA2G15 (a.k.a. ACS, GXVPLA2, LLPL, LPLA2, LYPLA3)
- Promoter CMV
-
Tag
/ Fusion Protein
- 6xHis (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TCCCAGGTCCAACTGCACCTCGGTTCTATCGATTGAATTC
- 3′ sequencing primer GCGGCCGCTAAGTAAGTAAGGATCCCCAGCTTGGCCGCCA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRK5-PLA2G15-6xHis S198A was a gift from Monther Abu-Remaileh (Addgene plasmid # 213605 ; http://n2t.net/addgene:213605 ; RRID:Addgene_213605) -
For your References section:
Glycerophosphodiesters inhibit lysosomal phospholipid catabolism in Batten disease. Nyame K., Hims, A., Aburous, A., Laqtom, N. N., Dong, W., Medoh, U. N., Heiby, J. C., Xiong, J., Ori, A., & Abu-Remaileh, M.. Molecular Cell, March 5 2024 10.1016/j.molcel.2024.02.006