pOTTC1993 - pAAV EF1a CoV2 protE-2xStrep
(Plasmid
#213543)
-
PurposeAAV viral vector packaging plasmid that expresses CoV2
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 213543 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepOTTC1464 - pAAV EF1a NheI iRFP-FLAG AscI
-
Backbone manufacturerNIDA GEVVC
- Backbone size w/o insert (bp) 5396
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCoV2 protE-2xStrep
-
SpeciesH. sapiens (human); Severe acute respiratory syndrome coronavirus 2
-
Insert Size (bp)330
-
Entrez GeneE (a.k.a. GU280_gp04)
- Promoter EF1a
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer EF-1a-Forward TCAAGCCTCAGACAGTGGTTC
- 3′ sequencing primer WPRE R1 CATAGCGTAAAAGGAGCAACA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byNIDA GEVVC
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pOTTC1993 - pAAV EF1a CoV2 protE-2xStrep was a gift from Brandon Harvey & Christopher Richie (Addgene plasmid # 213543 ; http://n2t.net/addgene:213543 ; RRID:Addgene_213543)