Skip to main content
Addgene

plx208-CMV-Signal seuqence-enkephalin-CapC-FLAG-μOR-NNES-SmBit
(Plasmid #213538)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 213538 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pLX208
  • Backbone size w/o insert (bp) 6772
  • Modifications to backbone
    no Hygromycin
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Signal seuqence-enkephalin-CapC-FLAG-μOR-NNES-SmBit
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1821
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site MluI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer cacatagcgtaaaaggagcaacatag
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    plx208-CMV-Signal seuqence-enkephalin-CapC-FLAG-μOR-NNES-SmBit was a gift from Wenjing Wang (Addgene plasmid # 213538 ; http://n2t.net/addgene:213538 ; RRID:Addgene_213538)

  • For your References section:

    A general method for chemogenetic control of peptide function. Shen J, Geng L, Li X, Emery C, Kroning K, Shingles G, Lee K, Heyden M, Li P, Wang W. Nat Methods. 2023 Jan;20(1):112-122. doi: 10.1038/s41592-022-01697-8. Epub 2022 Dec 8. 10.1038/s41592-022-01697-8 PubMed 36481965
Related items: