Skip to main content
Addgene

pRSF_his6_sumo_NL63_NSP14
(Plasmid #213520)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 213520 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pRSF-His6-sumo
  • Backbone size w/o insert (bp) 3900
  • Total vector size (bp) 5500
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    hCoV NL63 NSP14
  • Species
    hCoV NL63
  • Entrez Gene
    ORF1ab (a.k.a. HCNV63gp1)
  • Tag / Fusion Protein
    • His6-sumo (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer GGCTGATGGAAGCGTTCGCTA
  • 3′ sequencing primer T7-term
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRSF_his6_sumo_NL63_NSP14 was a gift from Thomas Tuschl (Addgene plasmid # 213520 ; http://n2t.net/addgene:213520 ; RRID:Addgene_213520)

  • For your References section:

    Small-molecule inhibition of SARS-CoV-2 NSP14 RNA cap methyltransferase. Meyer C, Garzia A, Miller MW, Huggins DJ, Myers RW, Hoffmann HH, Ashbrook AW, Jannath SY, Liverton N, Kargman S, Zimmerman M, Nelson AM, Sharma V, Dolgov E, Cangialosi J, Penalva-Lopez S, Alvarez N, Chang CW, Oswal N, Gonzalez I, Rasheed R, Goldgirsh K, Davis JA, Ramos-Espiritu L, Menezes MR, Larson C, Nitsche J, Ganichkin O, Alwaseem H, Molina H, Steinbacher S, Glickman JF, Perlin DS, Rice CM, Meinke PT, Tuschl T. Nature. 2024 Dec 11. doi: 10.1038/s41586-024-08320-0. 10.1038/s41586-024-08320-0 PubMed 39663451
Related items: