pJG01
(Plasmid #213505)

• Purpose: expresses TdTomato in Capsaspora owczarzaki
• Depositing Lab: Joseph Gerdt
• Publication: Plasmids for generating fluorescent Capsaspora owczarzaki (unpublished)

Backbone

• Vector backbone: pJP72
• Backbone manufacturer: Duojia Pan (based on pUC57-mini from Genscript)
• Backbone size w/o insert (bp): 4221
• Total vector size (bp): 5652
• Modifications to backbone: TdTomato was codon-optimized for Capsaspora owczarzaki and synthesized. The mScarlet gene ORF of pJP72 was directly replaced with the ORF of this TdTomato gene
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: TdTomato
• Species: Synthetic; ; Capsaspora owczarzaki
• Insert Size (bp): 1431
• Promoter: EF1

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: GATTTGGAAATGCTCACTCTTCC
• 3′ sequencing primer: TGAAATAAACAAATGTGTCTTGGC

Resource Information

• Supplemental Documents:
  • pjg01_cowc_tdtomato_final.gb
• A portion of this plasmid was derived from a plasmid made by: pJP72 was a gift from Duojia Pan (Addgene plasmid # 176479 ; http://n2t.net/addgene:176479 ; RRID:Addgene_176479)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry