pRRL-VcnTS-E1015A-E1021A
(Plasmid
#213411)
-
PurposeVinculin tension sensor (VcnTS) with both directionally asymmetric, force strengthening (DAFS) variant point mutations (E1015A and E1021A), in lentiviral expression vector.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 213411 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepRRL
- Backbone size w/o insert (bp) 6129
- Total vector size (bp) 11641
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameVcnTS-E1015A-E1021A
-
Alt nameVinTS-E1015A-E1021A
-
Alt nameVinculinTS-E1015A-E1021A
-
SpeciesG. gallus (chicken), Synthetic
-
Insert Size (bp)5512
-
MutationMutated vinculin glutamic acid 1015 and 1021 to alanine (E1015A and E1021A)
-
Entrez GeneVCL (a.k.a. VINC1)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRV (destroyed during cloning)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer GGTACAGTGCAGGGGAAAG
- 3′ sequencing primer GTTAAGAATACCAGTCAATCTTTCAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRRL-VcnTS-E1015A-E1021A was a gift from Brenton Hoffman (Addgene plasmid # 213411 ; http://n2t.net/addgene:213411 ; RRID:Addgene_213411) -
For your References section:
Molecular basis and cellular functions of vinculin-actin directional catch bonding. Chirasani VR, Khan MAI, Malavade JN, Dokholyan NV, Hoffman BD, Campbell SL. Nat Commun. 2023 Dec 14;14(1):8300. doi: 10.1038/s41467-023-43779-x. 10.1038/s41467-023-43779-x PubMed 38097542