pMDC32B-AtTAS1c-D2-NbSu-2-AtMIR173a
(Plasmid #213401)

• Purpose: Plant expression vector (2x35S) for expressing a syn-tasiRNA against Nicotiana benthamiana SULFUR gene from AtTAS1c precursor
• Depositing Lab: Alberto Carbonell
• Publication: Cisneros et al Plant J. 2022 May;110(4):1166-1181. doi: 10.1111/tpj.15730. Epub 2022 Mar 27.

Backbone

• Vector backbone: pMDC32
• Backbone size w/o insert (bp): 11888
• Total vector size (bp): 12899
• Vector type: Plant Expression
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Arabidopsis TAS1c with a syn-tasiRNA sequence at D2 for silencing N. benthamiana SULFUR gene. MIR173 cassette.
• Alt name: 35S:syn-tasiR-NbSu-2
• Species: A. thaliana (mustard weed)
• Insert Size (bp): 1011
• GenBank ID: AT2G39675 AT3G23125
• Promoter: 2x35S

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: attB1 (ACAAGTTTGTACAAAAAAGCAGGCT)
• 3′ sequencing primer: attB2 (ACCACTTTGTACAAGAAAGCTGGGT)

Resource Information

• Supplemental Documents:
  • pmdc32b-attas1c-d2-nbsu-2-atmir173.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry