pcVpx.myc
(Plasmid #213388)

• Purpose: Generate lentiviral vector which increases gene delivery into primary human myeloid cells
• Depositing Lab: Nathaniel Landau
• Publication: Sunseri et al J Virol. 2011 Jul;85(13):6263-74. doi: 10.1128/JVI.00346-11. Epub 2011 Apr 20.

Backbone

• Vector backbone: pcDNA6
• Total vector size (bp): 5438
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Depositing lab also uses HB101 E. coli for transformation.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: SIVmac vpx
• Alt name: Vpx
• Species: Simian Immunodeficiency Virus
• Insert Size (bp): 336
• Entrez Gene: vpx (a.k.a. SIVgp3)
• Promoter: CMV
• Tag / Fusion Protein:
  • myc-6xHis (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoR1 (unknown if destroyed)
• 3′ cloning site: Xho1 (unknown if destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG

Resource Information

• Supplemental Documents:
  • pcVpx-myc.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry