Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLKO human shRNA 2 DEPTOR
(Plasmid #21336)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 21336 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLKO.1
  • Backbone manufacturer
    Available from Addgene
  • Backbone size w/o insert (bp) 7032
  • Vector type
    Mammalian Expression, Lentiviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    XL10 Gold
  • Growth instructions
    XL10 Gold Ultracompetent Cells from Stratagene or nStb13. Grow in SOC media at 30oC. Can be tough to grow.
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    DEPTOR shRNA 2
  • Alt name
    DEPDC6
  • Alt name
    DEPTOR
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    60
  • Entrez Gene
    DEPTOR (a.k.a. DEP.6, DEPDC6, hDEPTOR)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer LKO.1 5'
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

human DEPTOR shRNA 2
TRC candidate; NM_022783.1-1101s1c1

shRNA oligo sequence - 5'-CCGGGCAAGGAAGACATTCACGATTCTCGAGAATCGTGAATGTCTTCCTTGCTTTTTG

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO human shRNA 2 DEPTOR was a gift from David Sabatini (Addgene plasmid # 21336 ; http://n2t.net/addgene:21336 ; RRID:Addgene_21336)
  • For your References section:

    DEPTOR Is an mTOR Inhibitor Frequently Overexpressed in Multiple Myeloma Cells and Required for Their Survival. Peterson TR, Laplante M, Thoreen CC, Sancak Y, Kang SA, Kuehl WM, Gray NS, Sabatini DM. Cell. 2009 May 13. ():. 10.1016/j.cell.2009.03.046 PubMed 19446321