SAM-DNMT3A-inactive+sgAAVS1_118
(Plasmid
#213171)
-
PurposeVector with sgAAVS1 used as a negative control (inactive DNMT3A) for induction of global DNA methylation.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 213171 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepXRP_502
-
Modifications to backboneRemoval of BsmBI site and insertion of Mutant DNMT3A E756A
-
Vector typeMammalian Expression, Lentiviral, CRISPR, Synthetic Biology
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgAAVS1_118
-
gRNA/shRNA sequenceCCCAGGCCACCTACTTGGCC
-
SpeciesH. sapiens (human)
-
GenBank IDGene ID: 1788
-
Entrez GeneAAVS1 (a.k.a. AAV)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
SAM-DNMT3A-inactive+sgAAVS1_118 was a gift from Sefi Rosenbluh (Addgene plasmid # 213171 ; http://n2t.net/addgene:213171 ; RRID:Addgene_213171) -
For your References section:
SAM-DNMT3A, a strategy for induction of genome-wide DNA methylation, identifies DNA methylation as a vulnerability in ER-positive breast cancers. Hosseinpour M, Xi X, Liu L, Malaver-Ortega L, Perlaza-Jimenez L, Joo JE, York HM, Beesley J, Caldon CE, Dugue PA, Dowty JG, Arumugam S, Southey MC, Rosenbluh J. Nat Commun. 2024 Dec 1;15(1):10449. doi: 10.1038/s41467-024-54824-8. 10.1038/s41467-024-54824-8 PubMed 39617792