pST
(Plasmid
#213143)
-
PurposeTtgV Biosensor
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 213143 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepQacR-Q2
-
Backbone manufacturerAlec Nielsen
- Backbone size w/o insert (bp) 5697
- Total vector size (bp) 7054
-
Modifications to backboneInsertion of TtgV-sfGFP biosensor circuit components
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameTtgV sfGFP Biosensor
-
Alt nametac-TtgV-sfGFP
-
Insert Size (bp)1832
- Promoter Tac
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TGACAATTAATCATCGGCTC
- 3′ sequencing primer GACGATGAGCGCATTGTTAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pST was a gift from Radhakrishnan Mahadevan (Addgene plasmid # 213143 ; http://n2t.net/addgene:213143 ; RRID:Addgene_213143) -
For your References section:
Design and Characterization of a Generalist Biosensor for Indole Derivatives. Pham C, Stogios PJ, Savchenko A, Mahadevan R. ACS Synth Biol. 2024 Jul 19;13(7):2246-2252. doi: 10.1021/acssynbio.3c00736. Epub 2024 Jun 14. 10.1021/acssynbio.3c00736 PubMed 38875315