Skip to main content
Addgene

pAAV-pTH-iCre:EGFP-WPREpA
(Plasmid #213142)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 213142 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pAAV
  • Backbone manufacturer
    Own plasmid
  • Backbone size w/o insert (bp) 4590
  • Total vector size (bp) 6366
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    iCre
  • Alt name
    Codon-optimized Cre
  • Insert Size (bp)
    1776
  • Promoter Truncated TH promoter from rat (Rattus norvegicus tyrosine hydroxylase promoter region)
  • Tag / Fusion Protein
    • EGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site MluI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer NA
  • 3′ sequencing primer TCCCTCACATCCTCAGGTTC
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The promoter is characterized in:
Lucas et al., Nanoscopic dopamine transporter distribution and conformation are inversely regulated by excitatory drive and D2 autoreceptor activity. Cell Rep. 2022 Sep 27; 40(13): 111431. doi: 10.1016/j.celrep.2022.111431

Støier et al., Amphetamine-induced reverse transport of dopamine does not require cytosolic Ca2+. J Biol Chem. 2023 Aug;299(8):105063. doi: 10.1016/j.jbc.2023.105063.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-pTH-iCre:EGFP-WPREpA was a gift from Ulrik Gether (Addgene plasmid # 213142 ; http://n2t.net/addgene:213142 ; RRID:Addgene_213142)

  • For your References section:

    Nanoscopic dopamine transporter distribution and conformation are inversely regulated by excitatory drive and D2 autoreceptor activity. Lycas MD, Ejdrup AL, Sorensen AT, Haahr NO, Jorgensen SH, Guthrie DA, Stoier JF, Werner C, Newman AH, Sauer M, Herborg F, Gether U. Cell Rep. 2022 Sep 27;40(13):111431. doi: 10.1016/j.celrep.2022.111431. 10.1016/j.celrep.2022.111431 PubMed 36170827
Related items:
Commonly requested with: