pAAV-pTH-iCre-WPREpA
(Plasmid
#213130)
-
PurposeTruncated rat TH promoter expressing iCre
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 213130 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
-
How this works
- Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV
-
Backbone manufacturerOwn plasmid
- Backbone size w/o insert (bp) 4590
- Total vector size (bp) 6366
-
Vector typeMammalian Expression, Mouse Targeting, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameiCre
-
Alt nameCodon-optimized Cre
-
Insert Size (bp)1056
- Promoter Truncated TH promoter from rat (Rattus norvegicus tyrosine hydroxylase promoter region)
-
Tag
/ Fusion Protein
- None
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site MluI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer NA
- 3′ sequencing primer TCCCTCACATCCTCAGGTTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The promoter is further characterized in Støier et al., Amphetamine-induced reverse transport of dopamine does not require cytosolic Ca2+. J Biol Chem. 2023 Aug;299(8):105063. doi: 10.1016/j.jbc.2023.105063.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-pTH-iCre-WPREpA was a gift from Ulrik Gether (Addgene plasmid # 213130 ; http://n2t.net/addgene:213130 ; RRID:Addgene_213130) -
For your References section:
Nanoscopic dopamine transporter distribution and conformation are inversely regulated by excitatory drive and D2 autoreceptor activity. Lycas MD, Ejdrup AL, Sorensen AT, Haahr NO, Jorgensen SH, Guthrie DA, Stoier JF, Werner C, Newman AH, Sauer M, Herborg F, Gether U. Cell Rep. 2022 Sep 27;40(13):111431. doi: 10.1016/j.celrep.2022.111431. 10.1016/j.celrep.2022.111431 PubMed 36170827