pαH-S-RRAR-OMICRON.BA.5
(Plasmid #213071)

• Purpose: Mammalian cell expression of SARS-CoV-2 Spike protein of Omicron.5 with with furin side intact
• Depositing Lab: Priyamvada Acharya
• Publication: Zhang et al bioRxiv [Preprint]. 2024 Mar 12:2024.02.12.580004. doi: 10.1101/2024.02.12.580004.

Backbone

• Vector backbone: pαH
• Backbone size w/o insert (bp): 4744
• Total vector size (bp): 8355
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: pαH-S-RRAR-OMICRON.BA.5
• Alt name: S-RRAR-IOmicron.BA.5
• Insert Size (bp): 3607
• Mutation: Ectodomain (AAs 1-1208); 682-685, furin site intact; T19I, del 24-26, A27S, del 69-70, G142D, V213G, G339D, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, L452R, S477N, T478K, E484A, F486V, Q493R, Q498R, N501Y, Y505H, D614G, H655Y, N679K,P681H, N764K, D796Y, Q954H, N969K
• Entrez Gene: S (a.k.a. GU280_gp02, spike glycoprotein)
• Tag / Fusion Protein:
  • HRV 3C cleavage site (before tags) C terminal on backbone 8X His tag C and 2X Strep-Tag II C terminal on backbone (C terminal on backbone)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: cctctgctaaccatgttcatgc

Resource Information

• Supplemental Documents:
  • 4487-6.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

A portion of this plasmid was derived from a plasmid made by Jason McLellan;