myc-tagged NRP1 (human)
(Plasmid #213068)

• Purpose: Express myc-NRP1 in mammalian cells
• Depositing Lab: Yoav Henis
• Publication: Res. Sq.-- NRP1 interacts with endoglin and VEGFR2 to modulate VEGF signaling and endothelial cell sprouting (unpublished)

Backbone

• Vector backbone: pcDNA3.1 Hygro
• Backbone size w/o insert (bp): 5597
• Total vector size (bp): 8397
• Vector type: Mammalian Expression
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: neuropilin 1
• Alt name: NRP1
• Species: H. sapiens (human)
• Insert Size (bp): 2801
• Mutation: N-terminal myc tag was introduced by a three-step PCR procedure
• GenBank ID: nc_000010.11
• Entrez Gene: NRP1 (a.k.a. BDCA4, CD304, NP1, NRP, VEGF165R)
• Promoter: T7
• Tag / Fusion Protein:
  • Myc (N terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: 5'-GAACAAAAACTCATCTCAGAAGAGGATCTG-3'
• 3′ sequencing primer: 5'-CAGATCCTCTTCTGAGATGAGTTTTTGTTC-3'

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The plasmid with the gene encoding NRP1 was obtained from Prof. Gera Neufeld, Technion, Israel. We have inserted an N-terminal myc tag.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

To generate the myc-NRP1, a three-step PCR procedure was employed. The first reaction used the T7 promoter primer and a reverse primer recognizing part of the myc tag sequence 5'- GGCGCTTTCGCGAACAAAAACTC -3'. The second reaction employed a forward primer recognizing the rest of the myc tag 5'- ATCTCAGAAGAGGATCTGAACGATAAATGTGGC-3' and a reverse primer recognizing the region encoding the C terminus of NRP1 5'- TATTCG GAGGCATGA CTCGAGGGG -3' . The third reaction used the above two PCR products as a template, using 5'- GAA CAA AAA CTC ATC TCA GAA GAG GAT CTG-3' as a forward primer and its complementary as a reverse primer, and generated one product containing NRP1 with myc tag inserted after nucleotide 23. The final PCR product was digested with BamHI and XhoI and inserted into pcDNA3.1 Hygro digested similarly.