pAG79-attL1-pegRNA-attL2
(Plasmid
#213050)
-
PurposeModular Unit carrying pegRNA and ngRNA scaffolds flanked by attL1 and attL2
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 213050 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCR8
- Total vector size (bp) 4468
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA
- Promoter 35S-CmYCLV-AtU6
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAGCCTAGAAGTAGTCAAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAG79-attL1-pegRNA-attL2 was a gift from Bing Yang (Addgene plasmid # 213050 ; http://n2t.net/addgene:213050 ; RRID:Addgene_213050) -
For your References section:
Modularly assembled multiplex prime editors for simultaneous editing of agronomically important genes in rice. Gupta A, Liu B, Raza S, Chen QJ, Yang B. Plant Commun. 2023 Oct 26:100741. doi: 10.1016/j.xplc.2023.100741. 10.1016/j.xplc.2023.100741 PubMed 37897041