pLenti_ABE8e-SpRY-P2A-BFP_HygroR
(Plasmid #213009)

• Purpose: A lentiviral vector used to create stable cell lines expressing the ABE8e-SpRY base editor and BFP
• Depositing Lab: Richard Sherwood
• Publication: Ryu et al Nat Genet. 2024 Apr 24. doi: 10.1038/s41588-024-01726-6.

Backbone

• Vector backbone: pLenti_mChe-P2A-BFP_HygroR
• Modifications to backbone: Swapped the mcherry construct with a D10A nickase mutant of the Cas9 variant SpRY. Added N-terminal ABE8e from a synthesized sequence block.
• Vector type: Mammalian Expression, Lentiviral, CRISPR
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: ABE8e-SpRY-D10A
• Species: Synthetic
• Mutation: D10A nickase variant of SpRY
• Promoter: Ef-1a

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ataagtgcagtagtcgccgt
• 3′ sequencing primer: ggttctcctccacgtctccag

Resource Information

• A portion of this plasmid was derived from a plasmid made by: David Liu (ABE8e-addgene plasmid # 152994) Benjamin Kleinstiver (SpRY-addgene plasmid # 139989)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry