pLenti_ABE8e-SpRY-P2A-BFP_HygroR
(Plasmid
#213009)
-
PurposeA lentiviral vector used to create stable cell lines expressing the ABE8e-SpRY base editor and BFP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 213009 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLenti_mChe-P2A-BFP_HygroR
-
Modifications to backboneSwapped the mcherry construct with a D10A nickase mutant of the Cas9 variant SpRY. Added N-terminal ABE8e from a synthesized sequence block.
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameABE8e-SpRY-D10A
-
SpeciesSynthetic
-
MutationD10A nickase variant of SpRY
- Promoter Ef-1a
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ataagtgcagtagtcgccgt
- 3′ sequencing primer ggttctcctccacgtctccag (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byDavid Liu (ABE8e-addgene plasmid # 152994) Benjamin Kleinstiver (SpRY-addgene plasmid # 139989)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti_ABE8e-SpRY-P2A-BFP_HygroR was a gift from Richard Sherwood (Addgene plasmid # 213009 ; http://n2t.net/addgene:213009 ; RRID:Addgene_213009) -
For your References section:
Joint genotypic and phenotypic outcome modeling improves base editing variant effect quantification. Ryu J, Barkal S, Yu T, Jankowiak M, Zhou Y, Francoeur M, Phan QV, Li Z, Tognon M, Brown L, Love MI, Bhat V, Lettre G, Ascher DB, Cassa CA, Sherwood RI, Pinello L. Nat Genet. 2024 Apr 24. doi: 10.1038/s41588-024-01726-6. 10.1038/s41588-024-01726-6 PubMed 38658794