Skip to main content
Addgene

lentiCRISPRv2FE-ABE8e-SpRY
(Plasmid #213008)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 213008 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    lentiCRISPRv2
  • Modifications to backbone
    Replaced original hairpin with FE hairpin. Swapped the Cas9 construct with a D10A nickase mutant of the Cas9 variant SpRY. Added N-terminal ABE8e from a synthesized sequence block.
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ABE8e-SpRY-D10A
  • Species
    Synthetic
  • Mutation
    D10A nickase variant of SpRY
  • Promoter Ef-1a

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ataagtgcagtagtcgccgt
  • 3′ sequencing primer gcaacaaacttctctctgctgaaacaagc
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Feng Zhang (Crisprv2 Plasmid-addgene plasmid # 52961) David Liu (ABE8e-addgene plasmid # 152994) Benjamin Kleinstiver (SpRY-addgene plasmid # 139989)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

FE Hairpin (Chen B, Gilbert LA, Cimini BA, Schnitzbauer J, Zhang W, Li GW, Park J, Blackburn EH, Weissman JS, Qi LS, Huang B. Dynamic imaging of genomic loci in living human cells by an optimized CRISPR/Cas system. Cell. 2013 Dec 19;155(7):1479-91. doi: 10.1016/j.cell.2013.12.001. Erratum in: Cell. 2014 Jan 16;156(1-2):373. PMID: 24360272; PMCID: PMC3918502.)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    lentiCRISPRv2FE-ABE8e-SpRY was a gift from Richard Sherwood (Addgene plasmid # 213008 ; http://n2t.net/addgene:213008 ; RRID:Addgene_213008)

  • For your References section:

    Joint genotypic and phenotypic outcome modeling improves base editing variant effect quantification. Ryu J, Barkal S, Yu T, Jankowiak M, Zhou Y, Francoeur M, Phan QV, Li Z, Tognon M, Brown L, Love MI, Bhat V, Lettre G, Ascher DB, Cassa CA, Sherwood RI, Pinello L. Nat Genet. 2024 Apr 24. doi: 10.1038/s41588-024-01726-6. 10.1038/s41588-024-01726-6 PubMed 38658794
Related items:
Commonly requested with: