lentiCRISPRv2FE-ABE8e-SpRY
(Plasmid #213008)

• Purpose: A lentiviral vector expressing the ABE8e-SpRY base editor and an sgRNA cloning site
• Depositing Lab: Richard Sherwood
• Publication: Ryu et al Nat Genet. 2024 Apr 24. doi: 10.1038/s41588-024-01726-6.

Backbone

• Vector backbone: lentiCRISPRv2
• Modifications to backbone: Replaced original hairpin with FE hairpin. Swapped the Cas9 construct with a D10A nickase mutant of the Cas9 variant SpRY. Added N-terminal ABE8e from a synthesized sequence block.
• Vector type: Mammalian Expression, Lentiviral, CRISPR
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: ABE8e-SpRY-D10A
• Species: Synthetic
• Mutation: D10A nickase variant of SpRY
• Promoter: Ef-1a

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ataagtgcagtagtcgccgt
• 3′ sequencing primer: gcaacaaacttctctctgctgaaacaagc

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Feng Zhang (Crisprv2 Plasmid-addgene plasmid # 52961) David Liu (ABE8e-addgene plasmid # 152994) Benjamin Kleinstiver (SpRY-addgene plasmid # 139989)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

FE Hairpin (Chen B, Gilbert LA, Cimini BA, Schnitzbauer J, Zhang W, Li GW, Park J, Blackburn EH, Weissman JS, Qi LS, Huang B. Dynamic imaging of genomic loci in living human cells by an optimized CRISPR/Cas system. Cell. 2013 Dec 19;155(7):1479-91. doi: 10.1016/j.cell.2013.12.001. Erratum in: Cell. 2014 Jan 16;156(1-2):373. PMID: 24360272; PMCID: PMC3918502.)